<<
>>

2.4 Оценка уровня мРНК генов ABCA1, LXRa, LXRfi, PPARy и MMP-9.

Для выделения тотальной мРНК и проведения реакции обратной транскрипции использовали наборы RNeasy Minikit (Qiagen, Нидерланды) и cDNA synthesis kit (Fermentas, Литва). Чистоту РНК оценивали по отношению поглощения при длинах волн 260 и 280 нм (критерий чистоты 1.8).

Уровень мРНК генов ABCA1, LXRa, LXRfi, PPARy и MMP-9 определяли методом количественной ПЦР в режиме реального времени с флуоресцентными зондами TaqMan на приборе CFX96 Touch (BioRad, США). В качестве референсного гена был использован конститутивно экспрессирующийся в клетках ген Р-актина (ACTB). Последовательности праймеров и зондов, использованные в данной работе (Бигль, Санкт-Петербург), представлены в Таблице 2.

Таблица 2

Нуклеотидные последовательности праймеров и проб
Последовательность праймеров ABCA1 FOR 5-GGGAGGCTCCCGGAGTT-3'

REV 5'-GTATAAAAGAAGCCTCCGAGCATC-3'

MMP-9 FOR 5'-CCTGGAGACCTGAGAACCAAT-3' REV 5'-GCCACCCGAGTGTAACCATAG -3'
LXRa FOR 5'-CTTGCTCATTGCTATCAGCAT CTT-3' REV 5' -ACATATGTGTGCTGCAGCCT CT-3'
LXRfi FOR 5-CTTCGCTAAGCAAGTGCCTG-3' REV 5'-GCAGCATGATCTCGATAGTGG-3'
PPARy FOR 5' - GATGTCTCATAATGCCATCAGGTT -3' REV 5'- GGATTCAGCTGGTCGATATCACT -3'
ACTB FOR 5 - CGTGCTGCTGACCGAGG-3'

REV 5' -ACAGCCTGGATAGCAACGTACA-3'

Последовательность проб, меченных флуоресцентной меткой ABCA1 5'-FAM-

AACTTTAACAAATCCATTGT GGCTCGCCTGT - RTQ1-3'

MMP-9 5'-FAM-

ACAGGCAGCT GGCAGAGGAATACCTGTAC- RTQ1-3

LXRa 5' -FAM-TCTGCAGACCGGCCCAACGTG -RTQ1-

3'

LXRft 5' -FAM- CGGGAGGACCAGATCGCCCT-RTQ1 -3'
PPARy 5' -FAM- CAGGCCGAGAAGGAGAAGCTGTTGG- RTQ1-3'
ACTB 5' -R6G-CCAACCGCGAGAAGATGACCCAGAT - BHQ1-3'

Зонды отжигались на кДНК в местах экзон-экзонных стыков с целью


исключения амплификации геномной ДНК. Амплификацию проводили в 25 мкл

реакционной смеси, содержащей 16,6 мМ (NH4)2SO4, 20 мМ Tris-HCl pH 8.8, 0.1% тритон X-100, 2.5мМ MgCl2, 0.25 мкМ каждого праймера, 0.7 мкМ каждого зонда TaqMan, 200 мкМ dNTP, 5 единиц активности Taq ДНК полимеразы фирмы «Fermentas» (Литва). После денатурации при 95°С в течение 10 мин проводили 45 циклов амплификации в следующем температурно-временном режиме: плавление - 95 °С 30 с, отжиг-синтез - 60°С 30 с.

В результате проведения ПЦР с использованием зонда на кДНК исследуемого гена и соответствующего референсного гена ACTB получали кинетические кривые, отображающие накопление ПЦР-продукта (Рисунок 11). Измерения для каждой пробы проводили в трех экземплярах. Относительное содержание мРНК генов ABCA, LXRa, LXRfi, PPARy и MMP-9 рассчитывали методом стандартных кривых. Стандартная кривая строилась в каждом эксперименте как для исследуемого гена, так и референсного гена ACTB (Рисунок 12).

Количество мРНК ABCA, LXRa, LXRfi, PPARy и MMP-9 нормировали по отношению к мРНК эндогенного гена ACTB, т.е. делили количество мРНК исследуемых генов, рассчитанное с использованием CFX96 (BioRad, США), на количество мРНК ACTB. Относительное содержание мРНК исследуемых генов рассчитывали методом стандартных кривых согласно методическим указаниям фирмы-изготовителя.

Рисунок 11. Кинетические кривые, отображающие накопление ПЦР- продукта.


Рисунок 12. Стандартные кривые.


2.5 Измерение уровня белка ABCA1.

Относительный уровень белка ABCA1 в макрофагах определяли методом вестерн-блоттинга. Для выделения мембранной фракции макрофаги лизировали в растворе следующего состава: 150 мМ NaCl, 1 % Triton X-100, 50 мМ Tris, pH 8, 0,5% дезоксихолат натрия, 0,1% SDS, включающем коктейль из ингибиторов протеаз (Roche, США). Количество общего белка определяли по методу Бредфорд с использованием реагентов фирмы «Силекс» (Россия) на спекртрофотометре SmartSpecTMPlus (BioRad, США). Равные количества белка макрофагальных лизатов смешивали с 4х буфером Лаемли (200мМ Tris-HCl pH 6,8, 400 мМ Р- меркаптоэтанол, 4 % додецилсульфат, 0,01 % бромфенол, 40 % гицерол (Laemmli et al., 1970) в соотношении 2 объема белка/1 объем буфера, после чего кипятили в течение 5 мин. при температуре 1000С. После кипячения пробы (5мкг на лунку), а также маркер молекулярного веса (Thermo Fisher Scientific, США), наносились на полиакриламидный гель (SDS-PAGE) с последующим проведением электрофореза в 1Х трисглициновом буфере (5Х стоковый раствор содержит: 25мМ Tris-HCl pH 8,8, 250 мM глицина (pH 8,3), 0,1 % додецилсульфата). После этого с использованием прибора для полусухого переноса Semi-dry (Хеликон, Москва) проводился перенос белка с полиакриламидного геля на PVDF мембрану (Millipore, Massachusetts, США) с использованием буфера для переноса (39 mM глицина, 48 мМ Tris-HCl pH 8,8, 0,037 % додецилсульфата, 20 % метанола). Далее согласно молекулярному весу белка ABCA1 и Р-актина мембрану разрезали и полученные фрагменты однократно промывали в растворе PBS, после чего производили их «забивку» 5% разведенным в растворе PBS обезжиренным сухим молоком в течение 1 часа при комнатной температуре. После «забивки» фрагмент PVDF мембраны, содержащий ABCA1, инкубировали с первичными кроличьими поликлональными антителами к ABCA1 (1:1000; ab7360, Abcam, Великобритания), а фрагмент PVDF мембраны, содержащий Р-актин, с антителами к В-актину (1:10000; ab8227, Abcam, Великобритания) в течение ночи при +4 0С. После этого трижды промывали в холодном растворе PBS фрагменты мембраны и инкубировали их в течение 1 часа при комнатной температуре со вторичными антикроличьими антителами, конъюгированными с пероксидазой хрена (1:3000; ab6721, Abcam, Великобритания). Затем снова трижды промывали холодным PBS. Далее связанные с соответствующим белком на обоих фрагментах мембраны вторичные антитела идентифицировали с использованием набора Amersham ECL Plus System (Amersham Biosciences, Великобритания) с использованием фотопленки CEA (Швеция).

Данные вестерн-блоттинга анализировали с помощью программы ImageJ (Версия 1.38a для Windows, http://rsb.info.nih.gov/ij/). Содержание ABCA1 нормировали к содержанию В-актина.

<< | >>
Источник: Демина Екатерина Петровна. Экспрессия генов транскрипционных факторов LXRalpha, LXRbeta, PPARgamma и транспортера ABCA1 при атеросклерозе. 2014
Помощь с написанием учебных работ

Еще по теме 2.4 Оценка уровня мРНК генов ABCA1, LXRa, LXRfi, PPARy и MMP-9.:

  1. Демина Екатерина Петровна. Экспрессия генов транскрипционных факторов LXRalpha, LXRbeta, PPARgamma и транспортера ABCA1 при атеросклерозе, 2014
  2. Занятие 10.8 ОЦЕНКА УРОВНЯ ПРИТЯЗАНИЙ
  3. Приложение 3 Оценка уровня устойчивости обучающихся к употреблению психоактивных веществ
  4. 3.1. Загрязнение окружающей среды токсикантами и количественные критерии оценки его фактического уровня
  5. Факторы, нарушающие равновесное состояние генов в генофонде популяции
  6. Дрейф генов как фактор эволюции
  7. 6.7. Оценка стоимости имущества. Виды оценки стоимости основных фондов, дооценка товарно-материальных ценностей.
  8. Уровни эволюции
  9. ЗАПИСЬ ИНФОРМАЦИИ НА КЛЕТОЧНОМ УРОВНЕ
  10. Уровни классификации
  11. Уровни личностных ценностей
  12. 3.3.Уровни общения
  13. Глава 2 Уровни культуры
  14. УРОВНИ ИЗМЕРЕНИЯ
  15. 2.7. Оценка максимального правдоподобия коэффициентов регрессии Оценка максимального правдоподобия
  16. Приложение 3 НЕЙРОЛОГИЧЕСКИЕ УРОВНИ
  17. Дифференциация по иерархическим уровням
  18. Понятие о популяционно-видовом уровне эволюции
  19. ВИДЫ И УРОВНИ ОБРАЗОВАНИЯ
  20. Глава 1. Биологические системы и уровни